ITS2 and psbA–trnH are used as standard and supplementary DNA barcodes for identifying herbal materials, respectively. The universal primers and the reaction conditions for the ITS2 barcode and the psbA–trnH barcode used for PCR amplification can be found in Table 1. PCR amplification was performed in 25 μL reaction mixtures containing approximately 30 ng of genomic DNA template, 1 X PCR buffer without MgCl2, 2.0 mM MgCl2,0.2 mM of each dNTP, 0.1 mM of each primer and 1.0 U Taq DNA Polymerase. The universal primers and the reaction conditions for the backup ITS barcode also can be found in Table 1. Purified PCR products need to be sequenced in both directions using PCR primers.
Table 1 The universal primers and the reaction conditions
|
Marker |
Name of primers |
Primer sequence(5′-3′) |
PCR reaction condition |
|
ITS2 |
2F |
ATGCGATACTTGGTGTGAAT |
94℃ 5 min |
|
|
3R |
GACGCTTCTCCAGACTACAAT |
94℃ 30 sec, 56℃ 30 sec, 72℃ 45 sec, 40 cycles |
|
|
|
|
72℃ 10 min |
|
ITS |
5F |
GGAAGTAAAAGTCGTAACAAGG |
94℃ 5 min |
|
|
4R |
TCCTCCGCTTATTGATATGC |
94℃ 1 min, 50℃ 1 min, 72℃ 1.5 min + 3 sec/cycle, 30 cycles |
|
|
|
|
72℃ 7 min |
|
psbA-trnH |
psbAF |
GTTATGCATGAACGTAATGCTC |
95℃4 min |
|
|
trnHR |
CGCGCATGGTGGATTCACAATCC |
94℃ 30 sec, 55℃ 1 min, 72℃ 1 min, 35 cycles |
|
|
|
|
72℃ 10 min |
|
psbA-trnH |
psbA |
CGAAGCTCCATCTACAAATGG |
95℃4 min |
|
|
trnH |
ACTGCCTTGATCCACTTGGC |
94℃ 30 sec, 55℃ 1 min, 72℃ 1 min, 35 cycles |
|
|
|
|
72℃ 10 min |
References:
Chen SL, Yao H, Han JP, et al. Validation of the ITS2 region as a novel DNA barcode for identifying medicinal plant species.PLoS ONE, 2010, 5: e8613.
Kress WJ, Wurdack KJ, Zimmer EA, et al. Use of DNA barcodes to identify flowering plants. ProcNatlAcadSci U S A, 2005, 102: 8369-74.
Kress WJ, Erickson DL. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbAspacer region. PLoS ONE, 2007, 2: e508
Sang T, Crawford DJ, Stuessy TF.Chloroplast DNA phylogeny, reticulate evolution and biogeography of Paeonia (Paeoniaceae).Am J Bot, 1997, 84: 1120-1136.
Tate JA, Simpson BB. Paraphyly of Tarasa (Malvaceae) and diverse origins of the polyploid species.Syst Bot, 2003, 28: 723-737.
White TJ, Bruns T, Lee S, Taylor J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M, Gelfand D, Swinsky J, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, CA: Academic Press, 1990: 315–322.